Multidisciplinary Collaborative Journal | Vol . 0 4 | Núm . 0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com ISSN: 3073 - 1356 1 Artic le Efficacy of Trichoderma sp. and Bacillus subtilis as biocontrol agents against Pseudocercospora fijiensis in the cultivation of banana ( Musa × paradisiaca ) Angel Virgilio Cedeño Moreira 1 , Kimberly López Cedeño 2 , Mauricio Renato Morejón Centeno 3 , Juan Antonio Torres Rodríguez 4 , Ketty Vanessa Arellano Ibarra 5 , Jorge Alberto Alejandre Rosas 6 and Alejandra Alvarado Mávil 7 * 1 Facultad de Ciencias Pecuarias y Biológicas, Universidad Técnica Estatal de Quevedo, Av. Quito km 1.5 vía a Santo Domingo, Quevedo 120501, Ecuador ; https://orcid.org/0000 - 0002 - 6564 - 5569 ; acedenom@uteq.edu.ec 2 Instituto Superior Tecnológico La Maná, Av. Amazonas entre Miguel Iturralde y Héroes del Cenepa, La Maná 050202, Ecuador ; https://orcid.org/0000 - 0002 - 6838 - 1474 ; klopez@istlm.edu.ec 3 Facultad de Ciencias Agrarias y Forestales, Universidad Técnica Estatal de Quevedo, Av. Quito km 1. 5 vía a Santo Domingo, Quevedo 120501, Ecuador ; https://orcid.org/0000 - 0002 - 2621 - 2306 ; mmorejonc@uteq.edu.ec 4 Facultad de Ciencias Agrarias y Forestales, Universidad Técnica Estatal de Quevedo, Av. Quito km 1.5 vía a Santo Domingo, Quevedo 120501, Ecuador ; https://orcid.org/0000 - 0003 - 3326 - 4371 ; jatorres@uteq.edu.ec 5 Facultad de Ciencias Pecuarias y Biológicas, Universidad Técnica Estatal de Quevedo, Av. Quito km 1.5 vía a Santo Domingo, Quevedo 120501, Ecuador ; https://orcid.org/0000 - 0001 - 7168 - 7485 ; Ketty.arellano2017@uteq.edu.ec 6 Facultad de Ciencias Químicas de Orizaba, Universidad Veracruzana, Oriente 6 No. 1009, Colonia Rafael Alvarado, CP. 94340 Orizaba, Mexico; https://orcid.org/0000 - 0002 - 1252 - 4966 ; jalejandre@uv.mx 7 Facultad de Ciencias Químicas de Orizaba, Universidad Veracruzana, Oriente 6 No. 1009, Colonia Rafael Alvarado, CP. 94340 Orizaba, Mexico; https://orcid.org/0009 - 0009 - 3041 - 8997 ; aalvarado@uv.mx * Correspondence: aalvarado@uv.mx https://doi.org/10.70881/mcj/v4/n2/145 Abstract: This study evaluated the efficacy of Trichoderma sp. and Bacillus subtilis as biocontrol agents against Pseudocercospora fijiensis , the fungus responsible for Black Sigatoka in bananas ( Musa × paradisiaca ). Under laboratory conditions, the inhibition of ascospore germination and radial growth was evaluated by applying Trichoderma sp. and B. subtilis metabolites at concentrations of 5% and 10 %. At a 10 % concentration, B. subtilis achieved 100% inhibition of ascospore germination and a 90 % reduction in radial growth of P . fi jiensis , outperforming Trichoderma , which achieved 60 % inhibition in both tests at the same concentration. In greenhouse trials, disease incidence and severity were measured in Cavendish banana seedlings inoculated with P . fijiensis and treated with weekl y foliar applications of the biocontrol agents. At a 10 % concentration, B. subtilis reduced disease severity to 10 %, while Trichoderma at 10 % achieved a 30 % reduction in severity, compared to the control, which maintained a constant severity of around 81 %. These results highlight the potential of B. subtilis as a robust biocontrol agent against P . fijiensis , providing a sustainable and effective alternative for managing Black Sigatoka in agricultural systems, thus reducing dependency on chemical fungic ides and promoting environmentally responsible cultivation practices. Cit ation : Cedeño Moreira, A. V., López Cedeño, K., Morejón Centeno, M. R., Torres Rodríguez, J. A., Arellano Ibarra, K. V., Alejandre Rosas, J. A., & Alvarado Mávil, A. (2026). Eficacia de Trichoderma sp. y Bacillus subtilis como agentes de control biológico contra Pseudocercospora fijiensis en el cultivo del plátano (Musa × paradisiaca). Multidisciplinary Collaborative Journal , 4 (2), 1 - 15. https://doi.org/10.70881/mcj/v4 /n2/145 Received: 02 /03/202 6 Revised: 06 /04 /2026 Accepted: 09 /04/2026 Published: 14 /04/2026 Copyright: 2026 by the authors. This article is an open access article distributed under the terms and conditions of the Creative Commons License, Attribution - NonCommercial 4.0 International (CC BY - NC). ( htt ps://creativecommons.org/licen ses/by - nc/4.0/ )
Multidisciplinary Collaborative Journal Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com 2 Palabras clave: biocontrol, ascospore germination, incidence, metabolites, radial growth Resumen : Este estudio evaluó la eficacia de Trichoderma sp. y Bacillus subtilis como agentes de biocontrol contra Pseudocercospora fijiensis , el hongo responsable de la Sigatoka Negra en banano ( Musa × paradisiaca ). Bajo condiciones de laboratorio, se evaluó la inhibición de la germinación de ascosporas y el crecimiento radial mediante la aplicación de metabolitos de Trichoderma sp . y B. subtilis en concentraciones de 5% y 10%. A una concentración de 10%, B. subtilis logró una inhibición del 100% de la germinación de ascosporas y una reducción del 90% en el crecimiento radial de P . fijiensi s , superando a Trichoderma , que logró una inhibición del 60% en ambas pruebas a la misma concentración. En ensayos de invernadero, se midió la incidencia y severidad de la enfermedad en plántulas de banano Cavendish inoculadas con P . fijiensis y tratadas c on aplicaciones foliares semanales de los agentes de biocontrol. Con una concentración del 10 %, B. subtilis redujo la gravedad de la enfermedad al 10 %, mientras que Trichoderma , al 10 %, logró una reducción del 30 % en la gravedad, en comparación con el control, que mantuvo una gravedad constante de alrededor del 81 %. Estos resultados resaltan el potencial de B. subtilis como un potente agente de biocontrol contra P . fijiensis , ofreciendo una alternativa sostenible y eficaz para el manejo de la Sigatoka Negra en sistemas agrícolas, reduciendo así la dependencia de fungicidas químicos y promoviendo prácticas de cultivo respetuosas con el medio ambiente. Keywords: Biocontrol, germinación de ascosporas, incidencia, metabolitos, crecimiento radial 1. Introduction Banana ( Musa × paradisiaca ) cultivation represents one of the most important economic and nutritional pillars in tropical and subtropical regions worldwide (Sau et al., 2023). This crop is a fundamental source of income and employment for mill ions of farmers and rural communities, in addition to being an important source of carbohydrates and other nutrients in human diets (Alonso et al., 2020). However, banana crops are severely threatened by various diseases, among which Black Sigatoka, caused by the fungus Pseudocercospora fijiensis , is particularly prominent (Esguera et al., 2024). Despite its agricultural and socioeconomic importance, banana cultivation is highly susceptible to foliar fungal diseases, which impair the plant’s photosynthetic capacity and significantly affect fruit yield and quality (Da Silva et al., 2023). Among these, leaf spot diseases caused by the fungus Pseudocercospora fijiensis (formerly Mycosphaerella fijiensis ) represent the most serious threat to the b anana industry, as this phyto pathogen has been the principal constraint on banana production over the past fifty years (Arango Isaza et al., 2016; Strobl & Mohan, 2020). This phytopathogen causes yield losses estimated at 33% to 70% in banana and plantain crops, and its management requires substantial investment in phytosanitary inputs (Arango Isaza et al., 2016 ; Chang et al., 2016 ). This disease causes premature leaf necrosis, drastically reducing the plant’s photosynthetic capacity and thereby affecting fruit yield and quality (Da Silva et al., 2023). Farmers facing Black Sigatoka are often forced to increase the use of chemical fungicides to control the disease, which, in the long term, leads to environmental, economic, and public health conseq uences (Esguera et al., 2024). Moreover, the excessive use of these products has fostered the emergence of resistant strains of P. fijiensis , thereby reducing the effectiveness of traditional chemical control methods (Palmieri et al., 2022).
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com 3 In recent year s, sustainable agriculture has gained prominence as a preferred approach to disease management, emphasizing the importance of reducing dependence on chemical products and promoting biological alternatives that enhance the natural resistance of plants ( Torr es - Rodriguez et al., 2021; Collinge et al., 2022; Elnahal et al., 2022). In this context, biocontrol agents such as Trichoderma spp. and B. subtilis have emerged as promising solutions because of their antagonistic properties and their ability to inhibit a wide range of phytopathogens (Lahlali et al., 2022). The genus Trichoderma includes fungi that have demonstrated efficacy in controlling fungal phyto pathogens through mechanisms such as competition for space and nutrients, mycoparasitism, and the producti on of antifungal compounds (Ty;kiewicz et al., 2022). Similarly, B. subtilis , a beneficial bacterium, has shown great potential for disease control through the production of metabolites that inhibit phytopathogen growth and stimulate systemic resistance in plants (Dimkić et al., 2022). The use of Trichoderma spp. and B. subtilis not only represents an effective strategy to reduce the incidence of Black Sigatoka, but also promotes environmentally responsible and cost - effective management (Dadrasnia et al., 2 020). Previous studies have documented that both biocontrol agents can adapt well to diverse conditions, persist in the environment, and provide continuous control of phytopathogens (Lahlali et al., 2022). However, the effectiveness of these species as bio control agents against P. fijiensis in banana cultivation requires thorough analysis under both laboratory and field conditions in order to evaluate their benefits and limitations in a real agricultural context (Cuellar et al., 2021). The objective of the present study is to evaluate the efficacy of Trichoderma spp. and B. subtilis as biocontrol agents for the management of P. fijiensis . Through this research, we aim to generate useful knowledge about the potential of these microorganisms in the biological control of Black Sigatoka, offering a sustainable and safe alternative that contributes to reducing the use of chemical fungicides in banana cultivation. This approach could improve the sustainability of agricultural production, reduce disease management c osts, and contribute to the ecological and socioeconomic well - being of banana - producing regions. 2. Methodology Strain Acquisition The Bacillus subtilis and Trichoderma s p . strains used in this study were obtained from the strain bank of the Biology and Microbiology Laboratory at the Technical State University of Quevedo (UTEQ). These strains had been previously isolated, characterized, and preserved under controlled conditions to ensure their viability and purity. The Trichoderma sp. strain was inoc ulated on potato dextrose agar (PDA; Difco, 39 g L ¹ ) and incubated at 25 ° C in darkness for 7 days. B . subtilis was inoculated on nutrient agar (NA) and incubated at 30 ° C for 24 h. On the other hand, the P . fijiensis strains used in this study were isola ted from a commercial banana plantation located in Valencia, Ecuador. The P . fijiensis strains were cultured on potato dextrose agar (PDA) and maintained at 25 °C in darkness for 15 days. Each strain was purified using the hyphal tip method, which allowed the acquisition of pure cultures by selecting and transferring only the tips of actively growing hyphae. This
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com 4 purification process ensured the elimination of potential contaminants, thereby guaranteeing the purity of the strains for use in the inhibition a ssays. Molecular identification of Pseudocercospora fijiensis For molecular identification, an rDNA fragment encompassing the ITS region (ITS1 5.8S ITS2) and extending toward the large subunit (2 8 S/LSU) was amplified using the specific primers MF137 (5 - GGCGCCCCCGGAGGTCTCCTT - 3) and R635 (5 - GGTCCGTGTTTCAAGACGG - 3), as described by Johanson and Jeger (1993), which generate an expected amplicon of approximately 1.0 kb (~1018 bp). The PCR reaction was performed in a final volume of 25 µL containi ng 1× buffer, MgCl ( 1.5 2.5 mM), dNTPs (0.2 mM each), primers (0.2 0.5 µ M each), Taq DNA polymerase (approximately 1 U), and template DNA (approximately 20 50 ng). Amplification was carried out with an initial denaturation at 94 °C, followed by 35 cycles of 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 45 s, with a final extension at 72 °C for 10 min. The amplified products were separated by electrophoresis on a 1.5% agarose gel in 1× TAE buffer at 90 110 V for 40 60 min and visu alized by staining with ethidium bromide or SYBR Safe under a UV transilluminator. Amplicon size was estimated by comparison with a 100 bp DNA ladder. A negative control without template DNA (C0) was included to rule out contamination. Determination of the incidence and severity of Pseudocercospora fijiensis in banana plantlets The incidence and severity of P. fijiensis were assessed under controlled greenhouse conditions. Cavendish banana plantlets obtained through in vitro propagation, approximately 30 cm in height, were used in the experiment. The plantlets were transplanted into 26 - cm - diameter pots at a density of one plant per pot and allowed to acclimatize for 14 days. The experimental design included an inoculated treatment and a no n - inoculated control, with 10 replicates per treatment. For inoculation, plantlets assigned to the inoculated treatment were sprayed with a spore suspension of P. fijiensis adjusted to 1 × 10d spores mL ¹ an d uniformly applied to both adaxial and abaxial l eaf surfaces. Immediately after inoculation, the plants were maintained in a humid chamber for 48 h to promote infection. Control plants were sprayed with sterile distilled water only and kept under the same environmental conditions (Torres - Rodriguez et al ., 2025) . Disease incidence was evaluated six weeks after inoculation and expressed as the percentage of infected plantlets relative to the total number of evaluated plants, according to the following equation: DI (%) = (IP / TP) × 100 where IP represents the number of infected plants and TP the total number of evaluated plants. Disease severity was determined in each of the 10 replicates by recording the total number of functional leaves and estimating the percentage of leaf area affected by Black Sigatok a symptoms on each leaf. Severity was scored using a seven - class visual scale (0 6) adapted from Orjeda (1998), where 0 = no symptoms; 1 = less than 1% infected leaf area; 2 = 1 5%; 3 = 6 15%; 4 = 16 33%; 5 = 34 50%; and 6 = 51 100%. The
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com 5 disease severity i ndex (DSI) was then calculated according to Craenen (1998) using the following equation: DSI (%) = [ %( nb) / ((N − 1) T )] × 100 where n is the number of leaves at each severity grade, b is the numerical value assigned to each grade, N is the total number of categories in the scale (7), and T is the total number of leaves evaluated per plant. Inhibition of Pseudocercospora fijiensis ascospore germination by metabolites produced by Trichoderma sp. and Bacillus subtilis The inhibition of P . fijiensis ascospore germination was assessed under laboratory conditions using metabolites produced by Trichoderma s p . and B. subtilis . Four treatments were evaluated: two concentrations of Trichoderma sp. metabolites (5% and 10%) and two concentrations of B. subtil is metabolites (5% and 10%). The metabolites were obtained from liquid cultures and filtered through Whatman No. 1 filter paper. For each treatment, 20 : L of an P . fijiensis ascospore suspension (1 × 10d spores mL ¹ ) w as mixed with 20 : L of the correspond ing metabolite solution in a sterile Petri dish. The negative control consisted of 20 : L of the ascospore suspension mixed with 20 : L of sterile distilled water. Each treatment, including the control, was replicated ten times, and the plates were incubate d at 25 °C in darkness for 48 h. Following incubation, ascospore germination was assessed by light microscopy at 40× magnification. For each replicate, five microscopic fields were randomly selected, and at least 100 spores were counted per treatment. Germ ination inhibition was calculated according to the following equation: AGI (%) = (UA / TA) × 100 where AGI represents the percentage of ascospore germination inhibition, UA is the number of ungerminated ascospores, and TA is the total number of ascospores observed. Radial Growth Inhibition of Pseudocercospora fijiensis The inhibitory effect of metabolites produced by Trichoderma sp. and B . subtilis on the radial growth of P . fijiensis colonies was evaluated under controlled laboratory conditions. Two concentrations of each metabolite (5% and 10%) were assessed, using dilutions prepared from liquid culture extracts of both microorganisms. In each Petri dish containing potato dextrose agar (PDA), a mycelial disc of P . fijiensis was placed at the center, and 50 : L of each metabolite solution was applied at equidistant points surrounding the disc. Plates were incubated at 25 °C in darkness, and colony radial growth was measured after 7 days. Radial growth inhibition was expressed as a percentage relative t o the untreated control. The percentage of radial growth inhibition was calculated according to the following equation (Torres - Rodr i guez et al., 2024): RGI (%) = [(R1 − R2) / R1] × 100
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com confirming both the specificity of the primers and the absence of contamination in the assay. Figure 1 Molecular identification of Pseudocercospora fijiensis by PCR amplification of the ITS region Note: (A) Genomic DNA extract ed from Pseudocercospora fijiensis isolates (M1 M4). (B) PCR amplification of the ITS region using the species - specific primers MF137 and R635, showing the expected ~1018 bp amplicon (red arrows) in isolates M1 M4. MP, DNA ladder; C0, no - template negative control. Infectivity of Pseudocercospora fijiensis in Banana Seedlings The incidence and severity of P . fijiensis varied significantly among the evaluated strains (Figure 2). M4 was the most virulent strain, showing the highest incidence (70%) an d severity (80%), whereas M3 exhibited the lowest values for both variables, with 30% incidence and 40% severity. M1 showed intermediate but relatively high levels of affectation, reaching 60% incidence and 64% severity, while M2 presented 42% incidence an d 58% severity. These findings reveal substantial variability in pathogenicity among the tested strains and identify M4 as the most aggressive isolate in banana seedlings. Figure 2 Incidence and severity of Pseudocercospora fijiensis in four strains (M1, M 2, M3, and M4) evaluated in banana seedlings b cd d a b b c a 0 50 100 M1 M2 M3 M4 Afectation (%) Strain Incidence
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com Note: Dark bars represent incidence, and light bars represent severity. Different letters above the bars indicate significant differences among strains within each variable according to Tukey’s test (P < 0.05). Ascospore Germination Inhibition Ascospore germination of P. fijiensis was significantly affected by the microbial metabolites evaluated (Figure 3). B . subtilis showed the highest inhibitory activity at both concentrations, reaching 80% i nhibition at 5% and complete inhibition (100%) at 10%. In contrast, metabolites from Trichoderma sp. produced lower inhibition values, with 47% at 5% and 60% at 10%. In both microorganisms, inhibition increased with metabolite concentration; however, B. su btilis consistently outperformed Trichoderma sp., indicating a stronger suppressive effect on ascospore germination. Figure 3 Inhibition of Pseudocercospora fijiensis ascospore germination by microbial metabolites Note: (A) Percentage of ascospore germination inhibition induced by metabolites produced by Trichoderma sp. and B. subtilis at 5% and 10%. Different letters above the bars indicate significant differences among treatments according to Tukey’s multiple comparison tes t (P < 0.05). (B) Representative microscopic images showing the effect of each treatment on ascospore germination. B1, B. subtilis at 10%; B2, B. subtilis at 5%; B3, Trichoderma sp. at 10%; and B4, Trichoderma sp. at 5%. Radial Growth Inhibition Radial gro wth of P . fijiensis differed significantly among the evaluated treatments (Figure 4). The strongest inhibition was observed with metabolites from B . subtilis at 10%, which reduced colony growth by 90% relative to the control. Metabolites from Trichoderma sp. at the same concentration produced 61% inhibition. At 5%, Trichoderma sp. showed moderate inhibitory activity (56%), whereas B. subtilis exhibited the lowest effect (26%). Overall, inhibition increased with concentration for B. subtilis , wh ile Trichoderma sp. maintained intermediate inhibition at both concentrations. These results indicate that B. c c b a 0 20 40 60 80 100 120 5% 10% Inhibition (%) Metabolite concentration Trichoderma B. subtilis A
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com ı subtilis , particularly at 10%, was the most effective treatment for suppressing mycelial growth of P. fijiensis . Representative images further sho wed that metabolite application induced evident morphological changes in P. fijiensis colonies, including irregular colony development and altered pigmentation at the margins. Such responses are consistent with fungal stress and reinforce the inhibitory ac tivity of the evaluated microbial metabolites against the phyto pathogen. Figure 4 Effect of microbial metabolites on the radial growth of Pseudocercospora fijiensis Note: (A) Radial growth inhibition (%) of P. fijiensis colonies treated with metabolites produced by Trichoderma sp. and B . subtilis at 5% and 10%. Different letters above the bars indicate significant differences among treatments according to Tukey’s multiple comparison test (P < 0.05). (B) Representative col ony morphology of P. fijiensis under each treatment. B1, B. subtilis at 10%; B2, B. subtilis at 5%; B3, Trichoderma sp. at 10%; and B4, Trichoderma sp. at 5%. Reduction of Disease Severity in Banana Seedlings The severity of P. fijiensis in banana seedlings was significantly reduced by the application of microbial treatments, although the magnitude of the effect depended on both the biological agent and the concentration used (Figure 5). At the 5% concentration, Trichoderma sp. reduced di sease severity to 62%, whereas B. subtilis reduced it to 59%. Both treatments showed lower severity than the phytopathogen - inoculated control, which reached 84%. A stronger reduction in disease severity was observed at the 10% concentration. B. subtilis wa s the most effective treatment, reducing severity to 10%, while Trichoderma sp. reduced it to 41%. In contrast, the control maintained a high severity value of 81%. Statistical analysis showed significant differences among treatments (P < 0.05), with B. su btilis at 10% showing the greatest suppressive effect on disease development. Overall, these results indicate that both B. subtilis and Trichoderma sp. have biocontrol potential b b c a 0 10 20 30 40 50 60 70 80 90 100 5% 10% Inhibition (%) Metabolite concentration Trichoderma B. subtilis B B B B A
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com against P. fijiensis in banana seedlings, although B. subtilis , particularly a t 10%, was the most effective treatment. Figure 5 Severity of Pseudocercospora fijiensis in banana seedlings treated with Trichoderma sp. and Bacillus subtilis Not e : (A) Severity (%) of P. fijiensis in banana seedlings treated with Trichoderma sp. and Bacillus subtilis at 5% and 10%, relative to the phyto pathogen - inoculated control. Different letters above the bars indicate significant differences among treatments according to Tukey’s multiple compar ison test (P < 0.05). The control is shown in both concentration groups for comparative purposes, although it represents a single treatment. (B) Representative leaf symptoms of P. fijiensis under each treatment. B1, B. subtilis at 10%; B2, Trichoderma sp. at 10%; B3, B. subtilis at 5%; B4, Trichoderma sp. at 5%; and B5 B6, phyto pathogen - inoculated control treated only with sterile water. 4. Discussion The variability in incidence and severity observed among P . fijiensis strains is likely associated with dif ferences in virulence - related traits among isolates. Previous studies have shown that P. fijiensis exhibits substantial genetic diversity, which enables rapid adaptation to different environmental conditions and host defense responses, thereby influencing its pathogenicity (Souleymane et al., 2022 ; Esguera et al., 2024 ). This genetic variability may be reflected in differences in the production of cell wall - degrading enzymes, toxins, and other infection - related compounds that facilitate host colonization an d tissue damage (Noar et al., 2022). Previous reports have indicated that some P. fijiensis isolates may have a greater capacity to produce effector molecules that suppress host defenses and increase disease severity (Pinheiro et al., 2022). In particular, highly virulent isolates, such as M4 in the present study, may possess specific genes involved in the regulation of pathogenicity - related compounds and enzymes that promote tissue colonization and lesion development (Olivares et al., 2021). In contrast, less aggressive isolates, such as d b cd a e e 0 10 20 30 40 50 60 70 80 90 100 5% 10% Severity (%) Treatments Trichoderma B. subtilis Control A
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com 11 M3, may express these virulence - related factors at lower levels, which could explain their reduced ability to infect host tissues and cause severe symptoms. The results of the present study are consistent with previous research reporting the effectiveness of B. subtilis as a biocontrol agent against phytopathogens through the production of secondary metabolites such as surfactins, iturins, and fengycins, which directly inhibit spore germination and pathogen growth (Zhu et al., 2020; Mahmood et al., 2022). These antimicrobial compounds disrupt cell membrane integrity, which may explain the strong inhibitory effect against P. fijiensis observed in this study. At the higher concentration tested (10% ), B. subtilis achieved complete inhibition, likely due to the increased availability of these bioactive metabolites, further supporting its potential as an effective biocontrol agent (Dimkić et al., 2022). Metabolites produced by Trichoderma sp. also show ed inhibitory activity against the pathogen, although their effect was less pronounced than that of B. subtilis . Previous studies have shown that Trichoderma spp. produce hydrolytic enzymes, such as glucanases and chitinases, which weaken phytopathogen cel l walls and reduce their capacity to infect host tissues (Konappa et al., 2020; Dutta et al., 2023). Although this mode of action may not result in complete inhibition as efficiently as the antibiotic compounds produced by B. subtilis , it can still substan tially reduce pathogen development, as observed in the present study, where inhibition reached 60% at the 10% concentration. The greater efficacy of B. subtilis compared with Trichoderma sp. in reducing disease severity in banana seedlings may be explained by differences in their modes of action. B. subtilis is widely recognized for its ability to produce antimicrobial metabolites, including surfactins, iturins, and fengycins, which directly affect pathogen cells by altering membrane permeability and suppre ssing mycelial growth (Elsharkawy et al., 2022; Ajuna et al., 2024). In addition, B. subtilis may activate induced systemic resistance in plants, thereby enhancing host defense against subsequent infections (Rabari et al., 2023; Jinal et al., 2024). The co mbined effect of direct antagonism and host defense stimulation likely explains the marked reduction in disease severity observed at the 10% concentration, where B. subtilis reduced severity to 10%. In contrast, Trichoderma sp. acts mainly through the prod uction of hydrolytic enzymes and through competition for space and nutrients, which can limit phyto pathogen establishment and development. In addition, some Trichoderma strains are known to promote plant defense responses and contribute indirectly to disea se suppression (Contreras et al., 2020; Poveda et al., 2020). These mechanisms may explain the reductions in severity observed at both 5% and 10%, although their effect was lower than that achieved with B. subtilis , particularly at the higher concentration . 5. Conclusions The results demonstrated significant variability in virulence among the evaluated Pseudocercospora fijiensis strains, with M4 showing the highest incidence and severity in banana seedlings. Among the microbial treatments, Bacillus subtilis exhibited the strongest antagonistic activity, particularly at the 10% concentration, where it achieved complete inhibition of ascospore germination, the highest radial growth inhibition, and
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com 12 the greatest reduction in disease severity. In contrast , Trichoderma sp. also showed inhibitory activity, although its effectiveness was consistently lower than that of B. subtilis . In addition to suppressing pathogen development, the microbial metabolites induced visible morphological alterations in P. fijien sis colonies, suggesting a direct antifungal effect. Under greenhouse conditions, the marked reduction in disease severity observed in banana seedlings treated with B. subtilis , especially at 10%, confirms its high potential as a biocontrol agent against B lack Sigatoka. Overall, these findings support the use of B. subtilis as a promising biological alternative for the management of P. fijiensis in banana production systems. Author Contributions: Conceptualization, A.V.C.M. and J.A.T.R .; methodology, A.V.C. M ., J.A.A.R and A.A.M .; formal analysis, M.R.M.C. , K.L.C. and K.V.A.I .; investigation, A.V.C.M ., K.V.A.I . and J.A.T.R .; resources, A.V.C.M. and K.V.A.I .; writing original draft preparation, A.A.M .; writing review and editing, J.A.A.R. and A.A.M. ; visualiza tion, M.R.M.C. and K.L.C.; supervision, J.A.T.R .; All authors have read and agreed to the published version of the manuscript. Funding: This research did not receive external funding. Acknowledgments: We would like to thank the Universidad Técnica Estatal de Quevedo (UTEQ) and the UTEQ Research Department for their ongoing support. Special thanks to the entire team at the UTEQ microbiology laboratory. Data availability statement: The data are available upon reasonable request from the correspondin g author at : aalvarado@uv.mx Conflicts of interest: The authors declare no conflict of interest. Referenc es Ajuna, H. B., Lim, H. I., Moon, J. H., Won, S. J., Choub, V., Choi, S. I., ... & Ahn, Y. S. (2024). The pros pect of antimicrobial peptides from Bacillus species with biological control potential against insect pests and diseases of economic importance in agriculture, forestry and fruit tree production. Biotechnology & Biotechnological Equipment, 38 (1), 2312115. https://doi.org/10.1080/13102818.2024.2312115 Alonso - Gómez, L. A., Solarte - Toro, J. C., Bello - Pérez, L. A., & Cardona - Alzate, C. A. (2020). Performance evaluation and economic anal ysis of the bioethanol and flour production using rejected unripe plantain fruits ( Musa paradisiaca L.) as raw material. Food and Bioproducts Processing, 121 , 29 - 42. https://doi.org/10.1016/j.fbp.20 20.01.005 Arango Isaza, R. E., Diaz - Trujillo, C., Dhillon, B., Aerts, A., Carlier, J., Crane, C. F., ... & Kema, G. H. (2016). Combating a global threat to a clonal crop: banana black Sigatoka pathogen Pseudocercospora fijiensis (synonym Mycosphaerella fij iensis) genomes reveal clues for disease control. PLoS Genetics, 12(8), e1005876. Chang, T. C., Salvucci, A., Crous, P. W., & Stergiopoulos, I. (2016). Comparative genomics of the Sigatoka disease complex on banana suggests a link between parallel evolutio nary changes in Pseudocercospora fijiensis and Pseudocercospora eumusae and increased virulence on the banana host. PLoS Genetics, 12(8), e1005904.
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com 13 Collinge, D. B., Jensen, D. F., Rabiey, M., Sarrocco, S., Shaw, M. W., & Shaw, R. H. (2022). Biological cont rol of plant diseases What has been achieved and what is the direction. Plant Pathology, 71 (5), 1024 - 1047. https://doi.org/10.1111/ppa.13555 Contreras - Cornejo, H. A., Macías - Rodríguez, L., del - Val, E., & La rsen, J. (2020). Interactions of Trichoderma with plants, insects, and plant pathogen microorganisms: chemical and molecular bases. In J. M. Mérillon & K. G. Ramawat (Eds.), Co - evolution of secondary metabolites (pp. 263 - 290). Springer. https://doi.org/10.1007/978 - 3 - 319 - 96397 - 6_23 Craenen, K., 1998. Technical Manual on Black Sigatoka Disease of Banana and Plantain. International Institute of Tropical Agriculture (IITA), Ibadan, Nigeria, p. 60. Cue llar - Gaviria, T. Z., González - Jaramillo, L. M., & Villegas - Escobar, V. (2021). Role of Bacillus tequilensis EA - CB0015 cells and lipopeptides in the biological control of black Sigatoka disease. Biological Control, 155 , 104523. https://doi.org/10.1016/j.biocontrol.2021.104523 Da Silva Magalhães, D., de Jesus Matos Viegas, I., da Silva Barata, H., Costa, M. G., da Silva, B. C., & de Lima Mera, W. Y. W. (2023). Deficiencies of nitrogen, calcium, and micronutrients are the most limiting factors for growth and yield of smell pepper plants. Revista Ceres, 70 (3), 125 135. https://doi.org/10.1590/0034 - 737x202370030013 Dadrasnia, A., Usman, M . M., Omar, R., Ismail, S., & Abdullah, R. (2020). Potential use of Bacillus genus to control of bananas diseases: Approaches toward high yield production and sustainable management. Journal of King Saud University - Science, 32 (4), 2336 2342. https://doi.org/10.1016/j.jksus.2020.03.011 Dimkić, I., Janakiev, T., Petrović, M., Degrassi, G., & Fira, D. (2022). Plant - associated Bacillus and Pseudomonas antimicrobial activities in plant disea se suppression via biological control mechanisms A review. Physiological and Molecular Plant Pathology, 117 , 101754. https://doi.org/10.1016/j.pmpp.2022.101754 Dutta, P., Mahanta, M., Singh, S. B., Thakuria, D., Deb, L., Kumari, A., ... & Pandey, A. K. (2023). Molecular interaction between plants and Trichoderma species against soil - borne plant pathogens. Frontiers in Plant Science, 14 , 1145715. https://doi.org/10.3389/fpls.2023.1145715 Elnahal, A. S. M., El - Saadony, M. T., Saad, A. M., Desoky, E. S. M., El - Tahan, A. M., Rady, M. M., & El - Tarabily, K. A. (2022). The use of microbial inoculants for biological control, plant growth promotion, and sustainable agriculture: A review. European Journal of Plant Pathology, 162 (4), 759 792. https://doi.org/10.1007/s10658 - 021 - 02393 - 7 Elsharkawy, M. M., Elsawy, M. M., & Ismail, I. A. (2022). Mechanism of resistance to Cucumber mosaic virus elicited by inoculation with Bacillus subtilis subsp. subtilis . Pest Management Science, 78 (1), 86 94. https://doi.org/10.1002/ps.6580 Esguera, J. G., Balendres, M. A., & Paguntalan, D. P. (2024). Overview of the Sigatoka leaf spot complex in banana and its current management. Tropical Plants, 3 (1), 1 15. https://doi.org/10.3390/tropicalplants 3010001
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com 14 Jinal, N. H., & Amaresan, N. (2020). Evaluation of biocontrol Bacillus species on plant growth promotion and systemic - induced resistant potential against bacterial and fungal wilt - causing pathogens. Archives of Microbiology, 202 (7), 1785 1794. https://doi.org/10.1007/s00203 - 020 - 01891 - 2 Johanson, A., & Jeger, M. J. (1993). Use of PCR for detection of Mycosphaerella fijiensis and M. musicola, the causal agents of Sigatoka leaf spots in banana and plantain. Mycological research, 97(6), 670 - 674. https://doi.org/10.1016/S0953 - 7562(09)80145 - 7 Konappa, N., Krishnamurthy, S., Dhamodaran, N., Arakere, U. C., Chowdappa, S., & Ramachandrappa, N. S. (2020). Opportunistic avirulent plant symbionts Trichoderma : Exploring its potential against soilborne phytopathogens. In C. Manoharachary, H. B. Singh, & A. Varma (Eds.), Trichoderma: Agricultural Applications and Beyond (pp. 219 255 ). Springer. https://doi.org/10.1007/978 - 3 - 030 - 54758 - 5_11 Lahlali, R., Ezrari, S., Radouane, N., Kenfaoui, J., Esmaeel, Q., El Hamss, H., ... & Barka, E. A. (2022). Biological control of plant pa thogens: A global perspective. Microorganisms, 10 (3), 596. https://doi.org/10.3390/microorganisms10030596 Mahmood, T., Fatima, R., & Maalik, S. (2022). Lipopeptides: Powerful antifungal weapons produced by Bacillus species. Plant Bulletin, 1 (1), 51 64. https://doi.org/10.3390/plants11070948 Noar, R. D., Thomas, E., & Daub, M. E. (2022). Genetic characteristics and metabolic interactions betw een Pseudocercospora fijiensis and banana: Progress toward controlling black Sigatoka. Plants, 11 (7), 948. https://doi.org/10.3390/plants11070948 Olivares, B. O., Rey, J. C., Lobo, D., Navas - Cortés, J. A., Gómez, J. A., & Landa, B. B. (2021). Fusarium wilt of bananas: A review of agro - environmental factors in the Venezuelan production system affecting its development. Agronomy, 11 (5), 986. https:/ /doi.org/10.3390/agronomy11050986 Orjeda, G., 1998. Evaluation of Musa Germplasm for Resistance to Sigatoka Diseases and Fusarium Wilt. INIBAP Technical Guidelines 3. International Plant Genetic Resources Institute, Rome, Italy. International Network for t he Improvement of Banana and Plantain, Montpellier, France; ACP - EU Technical Centre for Agricultural and Rural Cooperation, Wageningen, The Netherlands. Palmieri, D., Ianiri, G., Del Grosso, C., Barone, G., De Curtis, F., Castoria, R., & Lima, G. (2022). A dvances and perspectives in the use of biocontrol agents against fungal plant diseases. Horticulturae, 8 (7), 577. https://doi.org/10.3390/horticulturae8070577 Pinheiro, T. D. M., Rego, E. C. S., Alves, G. S. C., Fonseca, F. C. D. A., Cotta, M. G., Antonino, J. D., ... & Miller, R. N. G. (2022). Transcriptome profiling of the resistance response of Musa acuminata subsp . burmannicoides , var. Calcutta 4 to Pseudocercospora musae . International Journal of Molecular Sciences, 23 (21), 13589. https://doi.org/10.3390/ijms232113589 Poveda, J., Eugui, D., & Abril - Urias, P. (2 020). Could Trichoderma be a plant pathogen? Successful root colonization. In M. Zeilinger, I. Druzhinina, & G. Singh (Eds.),
Multidisciplinary Collaborative Journal | Vol.0 4 | Núm.0 2 | Abr Jun | 202 6 | https://mcjournal.editorialdoso.com 15 Trichoderma: Host Pathogen Interactions and Applications (pp. 35 59). Springer. https://doi.org/10.1007/978 - 3 - 030 - 54761 - 5_3 Rabari, A., Ruparelia, J., Jha, C. K., Sayyed, R. Z., Mitra, D., Priyadarshini, A., ... & Mohapatra, P. K. D. (2023). Articulating beneficial rhizobacteria - mediated plant defenses through induced system ic resistance: A review. Pedosphere, 33 (4), 556 566. https://doi.org/10.1016/S1002 - 0160(23)60038 - 0 Sau, S., Bhattacharjee, P., Kundu, P., & Mandal, D. (2023). Banana. In D. Mandal, U. Wermund, L . Phavaphutanon, & R. Cronje (Eds.), Tropical and Subtropical Fruit Crops (pp. 1 62). Apple Academic Press. https://doi.org/10.1201/9781003305033 - 1 Souleymane, S., Gnenakan, Y., Brahima, C., Leonard, O. S., & Daouda, K. (2022). Alternative strategy to the chemical control of Mycosphaerella fijiensis Morelet, causative agent of banana trees black Sigatoka by the use of biopesticides. American Journal of BioScience, 10 (3), 106 117. https://doi.org/10.11648/j.ajbio.20221003.14 Strobl, E., & Mohan, P. (2020). Climate and the global spread and impact of bananas’ black leaf Sigatoka disease. Atmosphere, 11(9), 947. Torres - Rodriguez, J. A., Reyes Pér ez, J. J., Ramos, L. T. L., Gonzalo - Matute, L., Rueda - Puente, E. O., & Hernandez - Montiel, L. G. (2025). Chitosan as a Postharvest Alternative for the Control of Phytophthora capsici in Bell Pepper Fruits. Sci, 7(2), 37. Torres - Rodriguez, J. A., Reyes - Pérez , J. J., Carranza - Patino, M. S., Gaibor - Fernández, R. R., Rivas - García, T., & Rueda - Puente, E. O. (2024). Chitosan: Biocontrol agent of Fusarium oxysporum in tomato fruit ( Solanum lycopersicum L.). Emirates Journal of Food and Agriculture, 36, 1 - 9. Torres - Rodriguez, J. A., Reyes - Perez, J. J., Castellanos, T., Angulo, C., Quinones - Aguilar, E. E., & Hernandez - Montiel, L. G. (2021). A biopolymer with antimicrobial properties and plant resistance inducer against phytopathogens: Chitosan. Notulae Botanica e Horti Agrobotanici Cluj - Napoca, 49(1), 12231 - 12231. Tyśkiewicz, R., Nowak, A., Ozimek, E., & Jaroszuk - Ściseł, J. (2022). Trichoderma : The current status of its application in agriculture for the biocontrol of fungal phytopathogens and stimulation of plan t growth. International Journal of Molecular Sciences, 23 (4), 2329. https://doi.org/10.3390/ijms23042329 Zhu, M. L., Wu, X. Q., Wang, Y. H., & Dai, Y. (2020). Role of biofilm formation by Bacillus pumilu s HR10 in biocontrol against pine seedling damping - off disease caused by Rhizoctonia solani . Forests, 11 (6), 652. https://doi.org/10.3390/f11060652